pet28a vector information


Alt Name: pET28a
Analyze: Sequence
Plasmid Type: Bacterial Expression
Expression Level: High
Cloning Method: Unknown
Size: 5369
5′ Sequencing 1 Primer: T7 Fwd
5′ Sequencing 1 Primer Sequence: 5’d[TAATACGACTCACTATAGGG]3′
Tag 1: His (Nterm and Cterm)
Bacterial Resistance: Kanamycin
Notes:
Nterm thrombin cleavage site; a,b,c vary by MCS;
Catalog Number: 69864-3
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

 

pet28a

 

 

 

 

 

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s