Dam-Dcm and CpG Methylation


Dam-Dcm and CpG Methylation

  • MY NEB
  • PRINT
  • PDF
  • DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

    Prokaryotic Methylation

    In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

    • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
    • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
    • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

    Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

    Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

    Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into adam, dcm strain of E. coli, such as dam/dcm Competent E. coli (NEB #C2925).

    Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

    Eukaryotic Methylation

    CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

    Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

    Methylation Sensitivity

    The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

    References

    1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
    2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
    3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
    4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

    Legend

    Not Sensitive Impaired
    Blocked Impaired by Overlapping
    Blocked by Overlapping Impaired by Some Combinations of Overlapping
    Blocked by Some Combinations of Overlapping

    Single Letter Code

    Enzyme Sequence Dam Dcm CpG
    AatII GACGT/C Not Sensitive Not Sensitive Blocked
    AbaSI Not Sensitive Not Sensitive Not Sensitive
    Acc65I G/GTACC Not Sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
    AccI GT/MKAC Not Sensitive Not Sensitive Blocked by Overlapping
    AciI CCGC(-3/-1) Not Sensitive Not Sensitive Blocked
    AclI AA/CGTT Not Sensitive Not Sensitive Blocked
    AcuI CTGAAG(16/14) Not Sensitive Not Sensitive Not Sensitive
    AfeI AGC/GCT Not Sensitive Not Sensitive Blocked
    AflII C/TTAAG Not Sensitive Not Sensitive Not Sensitive
    AflIII A/CRYGT Not Sensitive Not Sensitive Not Sensitive
    AgeI A/CCGGT Not Sensitive Not Sensitive Blocked
    AgeI-HF A/CCGGT Not Sensitive Not Sensitive Blocked
    AgeI-HF® RE-Mix® A/CCGGT Not Sensitive Not Sensitive Blocked
    AhdI GACNNN/NNGTC Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    AleI CACNN/NNGTG Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    AluI AG/CT Not Sensitive Not Sensitive Not Sensitive
    AlwI GGATC(4/5) Blocked Not Sensitive Not Sensitive
    AlwNI CAGNNN/CTG Not Sensitive Blocked by Overlapping Not Sensitive
    ApaI GGGCC/C Not Sensitive Blocked by Overlapping Blocked by Overlapping
    ApaLI G/TGCAC Not Sensitive Not Sensitive Blocked by Overlapping
    ApeKI G/CWGC Not Sensitive Not Sensitive
    ApoI R/AATTY Not Sensitive Not Sensitive Not Sensitive
    AscI GG/CGCGCC Not Sensitive Not Sensitive Blocked
    AscI RE-Mix® GG/CGCGCC Not Sensitive Not Sensitive Blocked
    AseI AT/TAAT Not Sensitive Not Sensitive Not Sensitive
    AsiSI GCGAT/CGC Not Sensitive Not Sensitive Blocked
    AvaI C/YCGRG Not Sensitive Not Sensitive Blocked
    AvaII G/GWCC Not Sensitive Blocked by Overlapping Blocked by Overlapping
    AvrII C/CTAGG Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    BaeGI GKGCM/C Not Sensitive Not Sensitive Not Sensitive
    BaeI (10/15)ACNNNNGTAYC(12/7) Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    BamHI G/GATCC Not Sensitive Not Sensitive Not Sensitive
    BamHI-HF® G/GATCC Not Sensitive Not Sensitive Not Sensitive
    BanI G/GYRCC Not Sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
    BanII GRGCY/C Not Sensitive Not Sensitive Not Sensitive
    BbsI GAAGAC(2/6) Not Sensitive Not Sensitive Not Sensitive
    BbvCI CCTCAGC(-5/-2) Not Sensitive Not Sensitive Impaired by Overlapping
    BbvI GCAGC(8/12) Not Sensitive Not Sensitive Not Sensitive
    BccI CCATC(4/5) Not Sensitive Not Sensitive Not Sensitive
    BceAI ACGGC(12/14) Not Sensitive Not Sensitive Blocked
    BcgI (10/12)CGANNNNNNTGC(12/10) Impaired by Overlapping Not Sensitive Blocked by Some Combinations of Overlapping
    BciVI GTATCC(6/5) Not Sensitive Not Sensitive Not Sensitive
    BclI T/GATCA Blocked Not Sensitive Not Sensitive
    BcoDI GTCTC(1/5) Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    BfaI C/TAG Not Sensitive Not Sensitive Not Sensitive
    BfuAI ACCTGC(4/8) Not Sensitive Not Sensitive Impaired by Overlapping
    BfuCI /GATC Not Sensitive Not Sensitive Blocked by Overlapping
    BglI GCCNNNN/NGGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    BglII A/GATCT Not Sensitive Not Sensitive Not Sensitive
    BlpI GC/TNAGC Not Sensitive Not Sensitive Not Sensitive
    BmgBI CACGTC(-3/-3) Not Sensitive Not Sensitive Blocked
    BmrI ACTGGG(5/4) Not Sensitive Not Sensitive Not Sensitive
    BmtI GCTAG/C Not Sensitive Not Sensitive Not Sensitive
    BmtI-HF® GCTAG/C Not Sensitive Not Sensitive Not Sensitive
    BpmI CTGGAG(16/14) Not Sensitive Not Sensitive Not Sensitive
    Bpu10I CCTNAGC(-5/-2) Not Sensitive Not Sensitive Not Sensitive
    BpuEI CTTGAG(16/14) Not Sensitive Not Sensitive Not Sensitive
    BsaAI YAC/GTR Not Sensitive Not Sensitive Blocked
    BsaBI GATNN/NNATC Blocked by Overlapping Not Sensitive Blocked by Some Combinations of Overlapping
    BsaHI GR/CGYC Not Sensitive Blocked by Some Combinations of Overlapping Blocked
    BsaI GGTCTC(1/5) Not Sensitive Blocked by Overlapping Blocked by Some Combinations of Overlapping
    BsaI-HF® GGTCTC(1/5) Not Sensitive Blocked by Overlapping Blocked by Some Combinations of Overlapping
    BsaJI C/CNNGG Not Sensitive Not Sensitive Not Sensitive
    BsaWI W/CCGGW Not Sensitive Not Sensitive Not Sensitive
    BsaXI (9/12)ACNNNNNCTCC(10/7) Not Sensitive Not Sensitive Not Sensitive
    BseRI GAGGAG(10/8) Not Sensitive Not Sensitive Not Sensitive
    BseYI CCCAGC(-5/-1) Not Sensitive Not Sensitive Blocked by Overlapping
    BsgI GTGCAG(16/14) Not Sensitive Not Sensitive Not Sensitive
    BsiEI CGRY/CG Not Sensitive Not Sensitive Blocked
    BsiHKAI GWGCW/C Not Sensitive Not Sensitive Not Sensitive
    BsiWI C/GTACG Not Sensitive Not Sensitive Blocked
    BslI CCNNNNN/NNGG Not Sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
    BsmAI GTCTC(1/5) Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    BsmBI CGTCTC(1/5) Not Sensitive Not Sensitive Blocked
    BsmFI GGGAC(10/14) Not Sensitive Blocked by Overlapping Blocked by Overlapping
    BsmI GAATGC(1/-1) Not Sensitive Not Sensitive Not Sensitive
    BsoBI C/YCGRG Not Sensitive Not Sensitive Not Sensitive
    Bsp1286I GDGCH/C Not Sensitive Not Sensitive Not Sensitive
    BspCNI CTCAG(9/7) Not Sensitive Not Sensitive Not Sensitive
    BspDI AT/CGAT Blocked by Overlapping Not Sensitive Blocked
    BspEI T/CCGGA Blocked by Overlapping Not Sensitive Impaired
    BspHI T/CATGA Blocked by Overlapping Not Sensitive Not Sensitive
    BspMI ACCTGC(4/8) Not Sensitive Not Sensitive Not Sensitive
    BspQI GCTCTTC(1/4) Not Sensitive Not Sensitive Not Sensitive
    BsrBI CCGCTC(-3/-3) Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    BsrDI GCAATG(2/0) Not Sensitive Not Sensitive Not Sensitive
    BsrFI R/CCGGY Not Sensitive Not Sensitive Blocked
    BsrGI T/GTACA Not Sensitive Not Sensitive Not Sensitive
    BsrI ACTGG(1/-1) Not Sensitive Not Sensitive Not Sensitive
    BssHII G/CGCGC Not Sensitive Not Sensitive Blocked
    BssKI /CCNGG Not Sensitive Blocked by Overlapping Blocked by Overlapping
    BssSI CACGAG(-5/-1) Not Sensitive Not Sensitive Not Sensitive
    BstAPI GCANNNN/NTGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    BstBI TT/CGAA Not Sensitive Not Sensitive Blocked
    BstEII  G/GTNACC Not Sensitive Not Sensitive Not Sensitive
    BstEII-HF® G/GTNACC Not Sensitive Not Sensitive Not Sensitive
    BstEII-HF® RE-Mix® G/GTNACC Not Sensitive Not Sensitive Not Sensitive
    BstNI CC/WGG Not Sensitive Not Sensitive Not Sensitive
    BstUI CG/CG Not Sensitive Not Sensitive Blocked
    BstXI CCANNNNN/NTGG Not Sensitive Blocked by Some Combinations of Overlapping Not Sensitive
    BstYI R/GATCY Not Sensitive Not Sensitive Not Sensitive
    BstZ17I GTA/TAC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    Bsu36I CC/TNAGG Not Sensitive Not Sensitive Not Sensitive
    BtgI C/CRYGG Not Sensitive Not Sensitive Not Sensitive
    BtgZI GCGATG(10/14) Not Sensitive Not Sensitive Impaired
    BtsCI GGATG(2/0) Not Sensitive Not Sensitive Not Sensitive
    BtsI GCAGTG(2/0) Not Sensitive Not Sensitive Not Sensitive
    BtsIMutI CAGTG(2/0) Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    Cac8I GCN/NGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    ClaI AT/CGAT Blocked by Overlapping Not Sensitive Blocked
    CspCI (11/13)CAANNNNNGTGG(12/10) Not Sensitive Not Sensitive Not Sensitive
    CviAII C/ATG Not Sensitive Not Sensitive Not Sensitive
    CviKI-1 RG/CY Not Sensitive Not Sensitive Not Sensitive
    CviQI G/TAC Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    DdeI C/TNAG Not Sensitive Not Sensitive Not Sensitive
    DpnI GA/TC Not Sensitive Not Sensitive Blocked by Overlapping
    DpnII /GATC Blocked Not Sensitive Not Sensitive
    DraI TTT/AAA Not Sensitive Not Sensitive Not Sensitive
    DraIII CACNNN/GTG Not Sensitive Not Sensitive Impaired by Overlapping
    DraIII-HF® CACNNN/GTG Not Sensitive Not Sensitive Impaired by Overlapping
    DrdI GACNNNN/NNGTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    DvuIII CACNCAC
    EnzymeBack to top Sequence Dam Dcm CpG
    EaeI Y/GGCCR Not Sensitive Blocked by Overlapping Blocked by Overlapping
    EagI C/GGCCG Not Sensitive Not Sensitive Blocked
    EagI-HF® C/GGCCG Not Sensitive Not Sensitive Blocked
    EarI CTCTTC(1/4) Not Sensitive Not Sensitive Impaired by Overlapping
    EciI GGCGGA(11/9) Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    Eco53kI GAG/CTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    EcoNI CCTNN/NNNAGG Not Sensitive Not Sensitive Not Sensitive
    EcoO109I RG/GNCCY Not Sensitive Blocked by Overlapping Not Sensitive
    EcoP15I CAGCAG(25/27) Not Sensitive Not Sensitive Not Sensitive
    EcoRI G/AATTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    EcoRI-HF® G/AATTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    EcoRI-HF® RE-Mix® G/AATTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    EcoRV GAT/ATC Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    EcoRV-HF® GAT/ATC Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    EcoRV-HF® RE-Mix® GAT/ATC Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    EnzymeBack to top Sequence Dam Dcm CpG
    FatI /CATG Not Sensitive Not Sensitive Not Sensitive
    FauI CCCGC(4/6) Not Sensitive Not Sensitive Blocked
    Fnu4HI GC/NGC Not Sensitive Not Sensitive Blocked by Overlapping
    FokI GGATG(9/13) Not Sensitive Impaired by Overlapping Impaired by Overlapping
    FseI GGCCGG/CC Not Sensitive Impaired by Some Combinations of Overlapping Blocked
    FspEI CC(12/16) Not Sensitive Not Sensitive Not Sensitive
    FspI TGC/GCA Not Sensitive Not Sensitive Blocked
    EnzymeBack to top Sequence Dam Dcm CpG
    HaeII RGCGC/Y Not Sensitive Not Sensitive Blocked
    HaeIII GG/CC Not Sensitive Not Sensitive Not Sensitive
    HgaI GACGC(5/10) Not Sensitive Not Sensitive Blocked
    HhaI GCG/C Not Sensitive Not Sensitive Blocked
    HincII GTY/RAC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    HindIII A/AGCTT Not Sensitive Not Sensitive Not Sensitive
    HindIII-HF® A/AGCTT Not Sensitive Not Sensitive Not Sensitive
    HinfI G/ANTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    HinP1I G/CGC Not Sensitive Not Sensitive Blocked
    HpaI GTT/AAC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    HpaII C/CGG Not Sensitive Not Sensitive Blocked
    HphI GGTGA(8/7) Blocked by Overlapping Not Sensitive Not Sensitive
    Hpy166II GTN/NAC Not Sensitive Not Sensitive Blocked by Overlapping
    Hpy188I TCN/GA Blocked by Some Combinations of Overlapping Not Sensitive Not Sensitive
    Hpy188III TC/NNGA Blocked by Overlapping Not Sensitive Blocked by Overlapping
    Hpy99I CGWCG/ Not Sensitive Not Sensitive Blocked
    HpyAV CCTTC(6/5) Not Sensitive Not Sensitive Impaired by Overlapping
    HpyCH4III ACN/GT Not Sensitive Not Sensitive Not Sensitive
    HpyCH4IV A/CGT Not Sensitive Not Sensitive Blocked
    HpyCH4V TG/CA Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
    I-SceI TAGGGATAACAGGGTAAT(-9/-13)
    EnzymeBack to top Sequence Dam Dcm CpG
    KasI G/GCGCC Not Sensitive Not Sensitive Blocked
    KpnI GGTAC/C Not Sensitive Not Sensitive Not Sensitive
    KpnI-HF® GGTAC/C Not Sensitive Not Sensitive Not Sensitive
    KpnI-HF® RE-Mix® GGTAC/C Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    LpnPI CCDG(10/14) Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    MboI /GATC Blocked Not Sensitive Impaired by Overlapping
    MboII GAAGA(8/7) Blocked by Overlapping Not Sensitive Not Sensitive
    MfeI C/AATTG Not Sensitive Not Sensitive Not Sensitive
    MfeI-HF® C/AATTG Not Sensitive Not Sensitive Not Sensitive
    MfeI-HF® RE-Mix® C/AATTG Not Sensitive Not Sensitive Not Sensitive
    MluCI /AATT Not Sensitive Not Sensitive Not Sensitive
    MluI A/CGCGT Not Sensitive Not Sensitive Blocked
    MlyI GAGTC(5/5) Not Sensitive Not Sensitive Not Sensitive
    MmeI TCCRAC(20/18) Not Sensitive Not Sensitive Blocked by Overlapping
    MnlI CCTC(7/6) Not Sensitive Not Sensitive Not Sensitive
    MscI TGG/CCA Not Sensitive Blocked by Overlapping Not Sensitive
    MseI T/TAA Not Sensitive Not Sensitive Not Sensitive
    MslI CAYNN/NNRTG Not Sensitive Not Sensitive Not Sensitive
    MspA1I CMG/CKG Not Sensitive Not Sensitive Blocked by Overlapping
    MspI C/CGG Not Sensitive Not Sensitive Not Sensitive
    MspJI CNNR(9/13) Not Sensitive Not Sensitive Not Sensitive
    MwoI GCNNNNN/NNGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    EnzymeBack to top Sequence Dam Dcm CpG
    NaeI GCC/GGC Not Sensitive Not Sensitive Blocked
    NarI GG/CGCC Not Sensitive Not Sensitive Blocked
    Nb.BbvCI CCTCAGC Not Sensitive Not Sensitive Not Sensitive
    Nb.BsmI GAATGC Not Sensitive Not Sensitive Not Sensitive
    Nb.BsrDI GCAATG Not Sensitive Not Sensitive Not Sensitive
    Nb.BtsI GCAGTG Not Sensitive Not Sensitive Not Sensitive
    NciI CC/SGG Not Sensitive Not Sensitive Impaired by Overlapping
    NcoI C/CATGG Not Sensitive Not Sensitive Not Sensitive
    NcoI-HF® C/CATGG Not Sensitive Not Sensitive Not Sensitive
    NcoI-HF® RE-Mix® C/CATGG Not Sensitive Not Sensitive Not Sensitive
    NdeI CA/TATG Not Sensitive Not Sensitive Not Sensitive
    NgoMIV G/CCGGC Not Sensitive Not Sensitive Blocked
    NheI G/CTAGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    NheI-HF® G/CTAGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    NheI-HF® RE-Mix® G/CTAGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    NlaIII CATG/ Not Sensitive Not Sensitive Not Sensitive
    NlaIV GGN/NCC Not Sensitive Blocked by Overlapping Blocked by Overlapping
    NmeAIII GCCGAG(21/19) Not Sensitive Not Sensitive Not Sensitive
    NotI GC/GGCCGC Not Sensitive Not Sensitive Blocked
    NotI-HF® GC/GGCCGC Not Sensitive Not Sensitive Blocked
    NotI-HF® RE-Mix®  GC/GGCCGC Not Sensitive Not Sensitive Blocked
    NruI TCG/CGA Blocked by Overlapping Not Sensitive Blocked
    NsiI ATGCA/T Not Sensitive Not Sensitive Not Sensitive
    NspI RCATG/Y Not Sensitive Not Sensitive Not Sensitive
    Nt.AlwI GGATC(4/-5) Blocked Not Sensitive Not Sensitive
    Nt.BbvCI CCTCAGC(-5/-7) Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    Nt.BsmAI GTCTC(1/-5) Not Sensitive Not Sensitive Blocked
    Nt.BspQI GCTCTTC(1/-7) Not Sensitive Not Sensitive Not Sensitive
    Nt.BstNBI GAGTC(4/-5) Not Sensitive Not Sensitive Not Sensitive
    Nt.CviPII (0/-1)CCD Not Sensitive Not Sensitive Blocked
    EnzymeBack to top Sequence Dam Dcm CpG
    PacI TTAAT/TAA Not Sensitive Not Sensitive Not Sensitive
    PacI RE-Mix® TTAAT/TAA Not Sensitive Not Sensitive Not Sensitive
    PaeR7I C/TCGAG Not Sensitive Not Sensitive Blocked
    PciI A/CATGT Not Sensitive Not Sensitive Not Sensitive
    PflFI GACN/NNGTC Not Sensitive Not Sensitive Not Sensitive
    PflMI CCANNNN/NTGG Not Sensitive Blocked by Overlapping Not Sensitive
    PhoI GG/CC Not Sensitive Impaired by Some Combinations of Overlapping Impaired by Some Combinations of Overlapping
    PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
    PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
    PleI GAGTC(4/5) Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    PluTI GGCGC/C Not Sensitive Not Sensitive Blocked
    PmeI GTTT/AAAC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    PmlI CAC/GTG Not Sensitive Not Sensitive Blocked
    PpuMI RG/GWCCY Not Sensitive Blocked by Overlapping Not Sensitive
    PshAI GACNN/NNGTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    PsiI TTA/TAA Not Sensitive Not Sensitive Not Sensitive
    PspGI /CCWGG Not Sensitive Blocked Not Sensitive
    PspOMI G/GGCCC Not Sensitive Impaired by Some Combinations of Overlapping Blocked by Overlapping
    PspXI VC/TCGAGB Not Sensitive Not Sensitive Impaired
    PstI CTGCA/G Not Sensitive Not Sensitive Not Sensitive
    PstI-HF® CTGCA/G Not Sensitive Not Sensitive Not Sensitive
    PvuI CGAT/CG Not Sensitive Not Sensitive Blocked
    PvuI-HF® CGAT/CG Not Sensitive Not Sensitive Blocked
    PvuII CAG/CTG Not Sensitive Not Sensitive Not Sensitive
    PvuII-HF® CAG/CTG Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    RsaI GT/AC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    RsrII CG/GWCCG Not Sensitive Not Sensitive Blocked
    EnzymeBack to top Sequence Dam Dcm CpG
    SacI GAGCT/C Not Sensitive Not Sensitive Not Sensitive
    SacI-HF® GAGCT/C Not Sensitive Not Sensitive Not Sensitive
    SacII CCGC/GG Not Sensitive Not Sensitive Blocked
    SalI G/TCGAC Not Sensitive Not Sensitive Blocked
    SalI-HF® G/TCGAC Not Sensitive Not Sensitive Blocked
    SalI-HF® RE-Mix® G/TCGAC Not Sensitive Not Sensitive Blocked
    SapI GCTCTTC(1/4) Not Sensitive Not Sensitive Not Sensitive
    Sau3AI /GATC Not Sensitive Not Sensitive Blocked by Overlapping
    Sau96I G/GNCC Not Sensitive Blocked by Overlapping Blocked by Overlapping
    SbfI CCTGCA/GG Not Sensitive Not Sensitive Not Sensitive
    SbfI-HF® CCTGCA/GG Not Sensitive Not Sensitive Not Sensitive
    ScaI AGT/ACT Not Sensitive Not Sensitive Not Sensitive
    ScaI-HF® AGT/ACT Not Sensitive Not Sensitive Not Sensitive
    ScaI-HF® RE-Mix® AGT/ACT Not Sensitive Not Sensitive Not Sensitive
    ScrFI CC/NGG Not Sensitive Blocked by Overlapping Blocked by Overlapping
    SexAI A/CCWGGT Not Sensitive Blocked Not Sensitive
    SfaNI GCATC(5/9) Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    SfcI C/TRYAG Not Sensitive Not Sensitive Not Sensitive
    SfiI GGCCNNNN/NGGCC Not Sensitive Impaired by Overlapping Blocked by Some Combinations of Overlapping
    SfoI GGC/GCC Not Sensitive Blocked by Some Combinations of Overlapping Blocked
    SgrAI CR/CCGGYG Not Sensitive Not Sensitive Blocked
    SmaI CCC/GGG Not Sensitive Not Sensitive Blocked
    SmlI C/TYRAG Not Sensitive Not Sensitive Not Sensitive
    SnaBI TAC/GTA Not Sensitive Not Sensitive Blocked
    SpeI A/CTAGT Not Sensitive Not Sensitive Not Sensitive
    SpeI RE-Mix® A/CTAGT Not Sensitive Not Sensitive Not Sensitive
    SpeI-HF® A/CTAGT Not Sensitive Not Sensitive Not Sensitive
    SphI-HF® GCATG/C Not Sensitive Not Sensitive Not Sensitive
    SphI GCATG/C Not Sensitive Not Sensitive Not Sensitive
    SspI AAT/ATT Not Sensitive Not Sensitive Not Sensitive
    SspI-HF® AAT/ATT Not Sensitive Not Sensitive Not Sensitive
    StuI AGG/CCT Not Sensitive Blocked by Overlapping Not Sensitive
    StyD4I /CCNGG Not Sensitive Blocked by Overlapping Impaired by Overlapping
    StyI C/CWWGG Not Sensitive Not Sensitive Not Sensitive
    StyI-HF® C/CWWGG Not Sensitive Not Sensitive Not Sensitive
    SwaI ATTT/AAAT Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    TaqαI T/CGA Blocked by Overlapping Not Sensitive Not Sensitive
    TfiI G/AWTC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    TliI C/TCGAG Not Sensitive Not Sensitive Impaired
    TseI G/CWGC Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    Tsp45I /GTSAC Not Sensitive Not Sensitive Not Sensitive
    Tsp509I /AATT Not Sensitive Not Sensitive Not Sensitive
    TspMI C/CCGGG Not Sensitive Not Sensitive Blocked
    TspRI NNCASTGNN/ Not Sensitive Not Sensitive Not Sensitive
    Tth111I GACN/NNGTC Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    XbaI T/CTAGA Blocked by Overlapping Not Sensitive Not Sensitive
    XbaI RE-Mix® T/CTAGA Blocked by Overlapping Not Sensitive Not Sensitive
    XcmI CCANNNNN/NNNNTGG Not Sensitive Not Sensitive Not Sensitive
    XhoI C/TCGAG Not Sensitive Not Sensitive Impaired
    XhoI RE-Mix® C/TCGAG Not Sensitive Not Sensitive Impaired
    XmaI C/CCGGG Not Sensitive Not Sensitive Impaired
    XmnI GAANN/NNTTC Not Sensitive Not Sensitive Not Sensitive
    EnzymeBack to top Sequence Dam Dcm CpG
    ZraI GAC/GTC Not Sensitive Not Sensitive Blocked
    Advertisements

    Leave a Reply

    Fill in your details below or click an icon to log in:

    WordPress.com Logo

    You are commenting using your WordPress.com account. Log Out / Change )

    Twitter picture

    You are commenting using your Twitter account. Log Out / Change )

    Facebook photo

    You are commenting using your Facebook account. Log Out / Change )

    Google+ photo

    You are commenting using your Google+ account. Log Out / Change )

    Connecting to %s